View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10652_low_9 (Length: 202)
Name: NF10652_low_9
Description: NF10652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10652_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 19378583 - 19378424
Alignment:
| Q |
1 |
cttgttggggtcacaaaattgtgtgattgactttgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378583 |
cttgttggggtcacaaaattgtgtgattgactttgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctggca |
19378484 |
T |
 |
| Q |
101 |
tttgcttgactcatcagataatttcaaactagactagtcattttggatcgacattatgat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378483 |
tttgcttgactcatcagataatttcaaactagactagtcattttggatcgacattatgat |
19378424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 4 - 157
Target Start/End: Complemental strand, 18018691 - 18018522
Alignment:
| Q |
4 |
gttggggtcacaaaattgtgtgattgactt-tgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctgg---- |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||| | | ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18018691 |
gttggagtcacaaaattgtgtgattgacttctgccacaacatctctgtttcatattgtattgtcgcatttaatcaatagtgaaacaatgaagctggaaat |
18018592 |
T |
 |
| Q |
99 |
-----------catttgcttgactcatcagataatttcaaactagactagtcattttggatcgacattat |
157 |
Q |
| |
|
|||||||||| |||||| | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018591 |
tctatctctattatttgcttgaatcatcacacaaattcaaactagactagtcattttggatcgacattat |
18018522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University