View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10653_4 (Length: 407)
Name: NF10653_4
Description: NF10653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10653_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 30 - 407
Target Start/End: Complemental strand, 34541551 - 34541174
Alignment:
| Q |
30 |
gttttagttttgtgtgaggctaattcgagactttaattcaactaattttaattattctatcgggttctgtgttgcttggtgtatttatgataattcaact |
129 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541551 |
gttttagttttgtgtgagggtaattcgggactttaattcaactaattttaattattctatcgggttctgtgttgcttggtgtatttatgataattcaact |
34541452 |
T |
|
| Q |
130 |
gcttttttaggatgcttgaaaagaggagtttgagctataatggtggaccgattcctgttccccttgacgaaccctttcttgcagataatgtgcaaagaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541451 |
gcttttttaggatgcttgaaaagaggagtttgagctataatggtggaccgattcctgttccccttgacgaaccctttcttgcagataatgtgcaaagaat |
34541352 |
T |
|
| Q |
230 |
ttgcgtttgtgatacaggtctctatcttttgtttgtttattttcaattgtctctatggtggttaactgttgattttattgctatcattatggagtggcaa |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541351 |
ttgcgtttgtgatacaggtctctatcttttgtttatttattttcaattgtctctatggtggttaactgttgattttattgctatcattatggagtggcaa |
34541252 |
T |
|
| Q |
330 |
gatatggaactcaatgatttgatttttaaagtatcatttttattttcgccaatctcaaattccattaagactgtctta |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34541251 |
gatatggaactcaatgatttgatttttaaagtatcatttttattttcgccaatctaaaattccattaagactgtctta |
34541174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University