View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10654_high_1 (Length: 381)
Name: NF10654_high_1
Description: NF10654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10654_high_1 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 235 - 381
Target Start/End: Original strand, 9586597 - 9586743
Alignment:
| Q |
235 |
aacaactaccatattgttctatcttttatgttttcagacattaagaaattgctgccgcattaagaacattttatcatctaaatcgtaactcaaatcttaa |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9586597 |
aacaactaccatattgttctatcttttatgttttcagacattaagaaattgttgccgcattaagaacattttatcatctaaatcgtaactcaaatcttaa |
9586696 |
T |
 |
| Q |
335 |
aaaatcaaatgccaaaccctctaatgcgatgatacaactatttaaaa |
381 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9586697 |
aaaatcaaatgacaaaccctctaatgcgatgatccaactatttaaaa |
9586743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University