View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10655_low_6 (Length: 220)
Name: NF10655_low_6
Description: NF10655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10655_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 38352955 - 38352752
Alignment:
| Q |
1 |
ttatgatgggcaagggaaacattgcgttgttt---ggagagaaaacaataccaaaggatgtgattttaatgttagaagaaacttgatagaggtcagaaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38352955 |
ttatgatgggcaagggaaacattgcgttgttttttggagagaaaacaataccaaaggatgtgattttaatgttagaagaaacttgatagaggtcagaaaa |
38352856 |
T |
 |
| Q |
98 |
aggtttgacnnnnnnnntaaaataaagaggagatgcgaacaattttttcaagagagatgatatagaagaagttgagttatacacatacattgttattgtt |
197 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38352855 |
aggtttgacaaaaaaac-aaaataaagaggagatgcgaacaattttttcaagagagatgatatagaagaagttgagttatacacatacattgttattgtt |
38352757 |
T |
 |
| Q |
198 |
taatt |
202 |
Q |
| |
|
||||| |
|
|
| T |
38352756 |
taatt |
38352752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University