View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10656_low_11 (Length: 203)
Name: NF10656_low_11
Description: NF10656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10656_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 16 - 184
Target Start/End: Complemental strand, 26501852 - 26501689
Alignment:
| Q |
16 |
atgaactcaggttgtactcatcacatttcttaatatgatatctcattgcatcaacaaagtcatgaaagtactgttaataatattaaagcttaagctagac |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26501852 |
atgaactccggttgtactcatcacatttcttaatatgatatctcattgcatcaacaaagtcatgaaagtactgttaata-tattaaagcttaagctagac |
26501754 |
T |
 |
| Q |
116 |
attaaacttgattagattcattaacataacataacataccaaaactatgttgacacccaatgtattgaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26501753 |
attaaacttgattagattcattaacatat----acataccaaaactatgttgacacccaatgcattgaa |
26501689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University