View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10656_low_2 (Length: 328)
Name: NF10656_low_2
Description: NF10656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10656_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 224 - 324
Target Start/End: Complemental strand, 8144917 - 8144817
Alignment:
| Q |
224 |
cagaggaacgtatttatgtttgacacatgatacagagagaacgacacgtggattttatttgtctttgttttacgggatgctactcgaaccttcacttcat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144917 |
cagaggaacgtatttatgtttgacacatgatacagagagaacgacacgtggattttatttgtctttgttttacgggatgctactcgaaccttcacttcat |
8144818 |
T |
|
| Q |
324 |
c |
324 |
Q |
| |
|
| |
|
|
| T |
8144817 |
c |
8144817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 8145128 - 8145054
Alignment:
| Q |
17 |
atagacatatggaaaaaccaattgcaaaatttcaagtccaagtgaaagaaaataagaatttgatatcaaatattt |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8145128 |
atagacatatggaaaaaccaattgcaaaatttcaagtccaagtgaaagaaaataagaatttgatatcaaatattt |
8145054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University