View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10656_low_9 (Length: 215)
Name: NF10656_low_9
Description: NF10656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10656_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 22 - 200
Target Start/End: Complemental strand, 15420550 - 15420374
Alignment:
| Q |
22 |
gatccaaattcttttggagatgaatgtgaaatgagcatgtcagattttatggacaaaccttggaaaccattaactagaaaagttcaaattccaggcgcta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420550 |
gatccaaattcttttggagatgaatgtgaaatgagcatgtcagattttatggacaaaccttggaaaccattaactagaaaagttcaaattccaggcgcta |
15420451 |
T |
|
| Q |
122 |
tactcagtccttataggtacctttcttaattatggtatatagtttttgttgcaatatgtataaaggttatatgtctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
15420450 |
tactcagtccttataggtacctttcttaattatgctatatagtttttgttacaata--tttaaaggttatatgtctatg |
15420374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University