View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10657_low_10 (Length: 226)
Name: NF10657_low_10
Description: NF10657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10657_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 45104232 - 45104042
Alignment:
| Q |
18 |
aactattaccttcttcaagccaggaatagtagctgaaagtgcaatgaacttttgtgatagctccaatcttctttttctctcagccataatgtgatccaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45104232 |
aactattaccttcttcaagccaggaatagtagctgaaagtgcaatgaacttttgtgatagttccaatcttctttttctctcagccataatgtgatccaaa |
45104133 |
T |
|
| Q |
118 |
cactgagaaccacttctactcttctttccagtttggttactagcttttgcttttggttctaaactcctcttattattattacttatactct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45104132 |
cactgagaaccacttctactcttctttccagtttggttactagcttttgcttttggttccaaactcctcttattattattacttctactct |
45104042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 45130855 - 45130668
Alignment:
| Q |
21 |
tattaccttcttcaagccaggaatagtagctgaaagtgcaatgaacttttgtgatagctccaatcttctttttctctcagccataatgtgatccaaacac |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| || | ||| |||||||||||||||||||||||||||| | || |
|
|
| T |
45130855 |
tattaccttctttaagccaggaatagtagctgaaagtgcaatgaacttctgtgataattctagtctcctttttctctcagccataatgtgatccagatac |
45130756 |
T |
|
| Q |
121 |
tgagaaccacttctactcttctttccagtttggttactagcttttgcttttggttctaaactcctcttattattattacttatactct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45130755 |
tgagaaccacttctactcttctttccagtttggttactagcttttgcttttggttccaaactcctcttattattattacttctactct |
45130668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 136
Target Start/End: Original strand, 1841244 - 1841357
Alignment:
| Q |
23 |
ttaccttcttcaagccaggaatagtagctgaaagtgcaatgaacttttgtgatagctccaatcttctttttctctcagccataatgtgatccaaacactg |
122 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||| || | || | |||| ||||| ||||||||| ||||| || ||||| | |||||| |
|
|
| T |
1841244 |
ttaccttgctcaagccgggaatagtggctgaaagtgcaatgaatttctcagacaactcctgtcttcgttttctctctgccattatatgatcaatacactg |
1841343 |
T |
|
| Q |
123 |
agaaccacttctac |
136 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
1841344 |
tgaactgcttctac |
1841357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University