View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10657_low_11 (Length: 224)
Name: NF10657_low_11
Description: NF10657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10657_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 564440 - 564640
Alignment:
| Q |
11 |
aagcagagatagcctatgaatcttaccaagagtggacccaagattcctaataaaaccaaacttagggcccttaagcttggtaaccattccaaagttgtga |
110 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
564440 |
aagcaaagataacctatgaatcttaccaagagtggacccaagattcctaataaaaccaaacttagggcccttaagcttggtaaccattccaaagttgtga |
564539 |
T |
 |
| Q |
111 |
caacaaaaccaatagacaaactcattgatcgatactgtctaattgagagctgctatttgattaaagttggcaacc--tttacaggtttttattattgtcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
564540 |
caacaaaaccaatagacaaactcattgatcgatactgtctaattgagagctgctatttgataaaagttggcaacctttttacaggtttttattattgtcc |
564639 |
T |
 |
| Q |
209 |
c |
209 |
Q |
| |
|
| |
|
|
| T |
564640 |
c |
564640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University