View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_high_16 (Length: 223)
Name: NF10658_high_16
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_high_16 |
 |  |
|
| [»] scaffold0024 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 148; Significance: 3e-78; HSPs: 4)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 65702 - 65862
Alignment:
| Q |
1 |
atattttctgtaagtagtttgctcaccatctcaattttcattctgttgcattattggttttgtttaatcttaaataaaagtcacaccaaatcttgatatc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65702 |
atattttctgtaagtagttt----accatctcaattttcattctgttgcattattggttttgtttaatcttaaataaaagtcacaccaaatcttgatatc |
65797 |
T |
 |
| Q |
101 |
ccctttatatattgaattattgatattatagattagtagcaattttcattctgtgaaattttcgg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65798 |
ccctttatatattgaattattgatattatagattagtagcaattttcattctgtgaaattttcgg |
65862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 30733 - 30878
Alignment:
| Q |
1 |
atattttctgtaagtagtttgctcaccatctcaattttcattctgttgcattattggttttgtttaatcttaaataaaagtcacaccaaatcttgatatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
30733 |
atattttctgtaagtagtttgctcaccatctcaattttctttgc----cat-----gttttgtttaatctgaaataaaagtcac--caaaatttgatatt |
30821 |
T |
 |
| Q |
101 |
ccctttatatattgaattattgatattatagattagtagcaattttcattctgtgaaattttcgg |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
30822 |
ccctttatatatt--------gatattatagattagtagcagttttcattctgtgaatttttcgg |
30878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 30991 - 31028
Alignment:
| Q |
164 |
ggaggaaagtcactactggtcaaccaatggaggtacct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30991 |
ggaggaaagtcactactggtcaaccaatggaggtacct |
31028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 65975 - 66012
Alignment:
| Q |
164 |
ggaggaaagtcactactggtcaaccaatggaggtacct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65975 |
ggaggaaagtcactactggtcaaccaatggaggtacct |
66012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University