View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_high_5 (Length: 266)
Name: NF10658_high_5
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 36864794 - 36864951
Alignment:
| Q |
18 |
ttccttcctttgcaagttgaagttccttctccaaatggtcaattttaatgtcaaaatcctgcttgtctttcaagagttcctcgcagcgttttttcagcag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36864794 |
ttccttcctttgcaagttgaagttccttctccaaatgttctattttaatgtcaaaatcctgcttgtctttcaagagttcctcgcagcg-tttttcagcag |
36864892 |
T |
 |
| Q |
118 |
ctttcttctcatcaatgagtgatctgagcatttgaaaaattgtgtcgtgctcttgttgg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36864893 |
ctttcttctcatcaatgagtgatctgagcatttgaaaaattgtgtcgtgctcttgttgg |
36864951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 229
Target Start/End: Original strand, 36864948 - 36864976
Alignment:
| Q |
201 |
ttggtgataaaagggatgtcaatacgaag |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36864948 |
ttggtgataaaagggatgtcaatacgaag |
36864976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University