View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_high_6 (Length: 257)
Name: NF10658_high_6
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 34279616 - 34279418
Alignment:
| Q |
19 |
tagagaccttactaaacttattggattggttgattcctcttttcaagtatactttttgtcacattctttgtcaattggtttatagatactcattaattat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279616 |
tagagaccttactaaacttattggattggttgattcctcttttcaagtatactttttgtcacattctttgtcaattggtttatagatactcattaattat |
34279517 |
T |
 |
| Q |
119 |
gattcttgtcatatttgttgtaaaatatgacaatatgtgcccatgttattattcgattgagtttgctatatttgttattgtaaactatgtaccttgacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279516 |
gattcttgtcatatttgttgtaaaatatgacattatgtgcccatgttattattcgattgagtttgctatatttgttattgtaaactatgtaccttgacg |
34279418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University