View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_14 (Length: 284)
Name: NF10658_low_14
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 12545044 - 12545324
Alignment:
| Q |
1 |
tggaagaaagtcttgacacaagaattggaaacacttcaatccaataaaacttggaagcttgttgatttgccactaggagtcactcctatagtaagaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
12545044 |
tggaagaaagtcttgacacaagaattggaaacacttcaatccaataaaacttagaagcttgttgatttgccactaggagtctctcctataggaagaaaat |
12545143 |
T |
 |
| Q |
101 |
gggttttcaagataaagagaaagcactacggaactgtagatagatataatgcaagataggttgca-------------aaagggaatgacatgagaagct |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12545144 |
gggttttctagataaagagaaagcactacggaactgtagatagatataatgcaagataggttgcaaaagggtataatcaaagggaatgacatgagaagct |
12545243 |
T |
 |
| Q |
188 |
tatttcaactctcttaactgatggttttaatcaggaaactttcagatcactcatagtttatcaagcacaaggatccattat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12545244 |
tatttcaactctcttaactgatggttttaatcaggaaactttcagatcactcatagtttatgaagcacaaggatccattat |
12545324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University