View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_15 (Length: 278)
Name: NF10658_low_15
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 14 - 263
Target Start/End: Original strand, 25952522 - 25952771
Alignment:
| Q |
14 |
tggacatcattgcttcgcttgtcaacgactccagtgtagaggatgacaggtccttgacctgggatgatcgtggccgacccggaccaacaaccgtatttgt |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952522 |
tggacctcattgcttcgcttgtcaacgactccagtgtagaggatgacaggtccttgacctgggatgatcgtggccgacccggaccaacaaccgtatttgt |
25952621 |
T |
|
| Q |
114 |
caaagggtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttgatactgagtgcccccacacaatgttaccccaaacagctcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952622 |
caaagggtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttgatactgagtgcccccacacaatgttaccccaaacagctcc |
25952721 |
T |
|
| Q |
214 |
tttgggattgtactggtaaaatagatggtagactcctctgtagtacatgg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952722 |
tttgggattgtactggtaaaatagatggtagactcctctgtagtacatgg |
25952771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 83 - 237
Target Start/End: Complemental strand, 42590512 - 42590358
Alignment:
| Q |
83 |
gtggccgacccggaccaacaaccgtatttgtcaaagggtttggatgggtatagtgcaggttgaagttctttccaattgatgagatcctttgatactgagt |
182 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||| |||||||| | ||||||| |||| ||||||| || || ||||||||||||||||||| |
|
|
| T |
42590512 |
gtggctgacccggaccaacatccgtatttgtcgaagggtttagatgggtagatagcaggttcaagtgctttccagtttataagatcctttgatactgagt |
42590413 |
T |
|
| Q |
183 |
gcccccacacaatgttaccccaaacagctcctttgggattgtactggtaaaatag |
237 |
Q |
| |
|
| ||||||||||||| ||||| |||| |||||| || ||||||||||| ||||| |
|
|
| T |
42590412 |
gggcccacacaatgtttccccatacagatccttttgggttgtactggtagaatag |
42590358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 42875886 - 42875962
Alignment:
| Q |
164 |
agatcctttgatactgagtgcccccacacaatgttaccccaaacagctcctttgggattgtactggtaaaatagatg |
240 |
Q |
| |
|
|||||||||||| |||| || |||||||||| || ||||||||||| ||||| |||||||| ||||| || ||||| |
|
|
| T |
42875886 |
agatcctttgatgctgaatgggcccacacaatatttccccaaacagcaccttttggattgtattggtagaacagatg |
42875962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University