View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_21 (Length: 250)
Name: NF10658_low_21
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 60 - 242
Target Start/End: Complemental strand, 34279313 - 34279138
Alignment:
| Q |
60 |
atgaaagatgtgaagattagtgatgatttgagaagttatcttttgtgagactacttgattggtcttatagtgccaaatactttttcttttgggattttgt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
34279313 |
atgaaagatgtgaagattagtgatgatttgagaagttatcttttgtgagactacttgattggtcgtatagtgccaaatactttttcttttg-------gt |
34279221 |
T |
 |
| Q |
160 |
tcattgacgctctctctaatggtgatgccaaaggaannnnnnnngaaggaccaaaggaatttgtaatcatgtacatctctgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34279220 |
tcattgacgctctctctaatggtgatgccaaaggaattttttttgaaggaccaaaggaatttgtaatcatgtacatctttgct |
34279138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University