View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_24 (Length: 249)
Name: NF10658_low_24
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 11781414 - 11781649
Alignment:
| Q |
1 |
tttcattatgaactttacttttcgacgtttctgtctgtataacttgatgattttcagattcaaaacttgatttaaatgttgctattggtgcggatacctg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11781414 |
tttcattatgaactttactttttgacgtttctgtctgtataacttgatgattttcagattcaaaacttgatttaaatgttgctattggtgcggatacctg |
11781513 |
T |
 |
| Q |
101 |
agaagcaatgggagcttgtgatggtgctattactattgcaccagaatcagaaccttcaggggcatgaaactccatcgaaattgagtgtggctgatcattt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11781514 |
agaagcaatgggagcttgtggtggtgctattactattgcaccagaatcagaacctgcaggggcatgaaactccatcgaaattgagtgtggctgatcattt |
11781613 |
T |
 |
| Q |
201 |
gtttccacgccataatgctgaacctcatgatgttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11781614 |
gtttccacgccataatgctgaacctcatgatgttct |
11781649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University