View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_28 (Length: 240)
Name: NF10658_low_28
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 8216849 - 8217071
Alignment:
| Q |
18 |
ctctactcctccaataatcatttattcaaaataactctaaaaccaacatcaaattgaaagataatgtcacagtattctagggtggtgagcaatatggttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8216849 |
ctctactcctccaataatcatttattcaaaataactctaaaaccaacatcaaattgaaagataatgtcacactattctagggtggtgagcaatatggttt |
8216948 |
T |
|
| Q |
118 |
gtgttgattttcagtattaatttgagagacacgcagtattaactttgctctatttgaattggggaaagaaattcataacgcatgtatgggccttgaactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8216949 |
gtgttgattttcagtattaatttgagagacacgcagtattaattttgctctatttgaattggggaaagaaattcataacgcatgtatgggccttgaactt |
8217048 |
T |
|
| Q |
218 |
gacatcatatcgcatgtaggtcc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8217049 |
gacatcatatcgcatgtaggtcc |
8217071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 78
Target Start/End: Complemental strand, 8255495 - 8255457
Alignment:
| Q |
40 |
tattcaaaataactctaaaaccaacatcaaattgaaaga |
78 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8255495 |
tattcaaaataaatttaaaaccaacatcaaattgaaaga |
8255457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University