View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_37 (Length: 227)
Name: NF10658_low_37
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 36440300 - 36440104
Alignment:
| Q |
18 |
cttgccactcacttgacaccataacactgaaccaatcattggaagacaacgatgttttggtctccaaccctcgaggaacctttgcacttggtttcttcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440300 |
cttgccactcacttgacaccataacactgaaccaatcattggaagacaacgatgttttggtctccaaccctcgaggaacctttgcacttggtttcttcac |
36440201 |
T |
 |
| Q |
118 |
cctacagaaagattctaaaacacgataccttggtatatggtacaacaaaatttcagaacaaaccattgtttgggttgcaaacagagatactcctttg |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440200 |
cttacagaaagattctaaaacacgataccttggtatatggtacaacaaaatttcagaacaaaccattgtttgggttgcaaacagagatactcctttg |
36440104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University