View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10658_low_6 (Length: 361)
Name: NF10658_low_6
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10658_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 55 - 350
Target Start/End: Complemental strand, 45146312 - 45146023
Alignment:
| Q |
55 |
tgtccacaaatatagtagaatttgtaaccatatatcattaggaagtgatgatgaacagaccagaccggttacatggtttgaattgttgctcccatattgc |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
45146312 |
tgtccacaaatatagtagaatttgtaaccatatatcattaggaagtgatgatgaacagagc-----ggttacatggtttgaattgttgctcccatattgc |
45146218 |
T |
|
| Q |
155 |
tacgagcacatcccctcgtgatgggagggtgtgaataacgtagttgatctaatgctaaattgaacctatccgttagatcctggactgcgagcgtctgagc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45146217 |
tacgagcacatcccctcgtgatgggagggtgtgactaacgtagttgatctaatgctaaattgaacctatccgttagatcttggactgcgagcgtctgagc |
45146118 |
T |
|
| Q |
255 |
attctaaaacaccaataaacgtctgatctattacgcgtgcatcgctctgat-gtatagtcaagactcttttcaaacgcaattagatcctctttgacc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45146117 |
attctaaaacaccaataaacgtctgatctattacgcgtgcaccgctctgatcgtgtagtcaaga--cttttcaaacgcaattagatcctctttgacc |
45146023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 45146370 - 45146332
Alignment:
| Q |
19 |
taagtctctttatatagaggaggtgcatgttatcggtgt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45146370 |
taagtctctttatatagaggaggtgcatgttatcggtgt |
45146332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University