View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10659_low_6 (Length: 281)
Name: NF10659_low_6
Description: NF10659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10659_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 123 - 269
Target Start/End: Original strand, 26841728 - 26841874
Alignment:
| Q |
123 |
aagatgtcaatgttgttctaatgttggtttttctgaatgtttgtgtagtattaggtgcactaaatatgttgttttgtggttttgacagatttgcctgttt |
222 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26841728 |
aagatgacaatgttgttctaatgttggtttttctgaatgtttgggtagtattaggtgcactaaatatgttgttttggggttttgacagatttgcctgttt |
26841827 |
T |
|
| Q |
223 |
gttttaatcccctgtgtggttctctgtaagcggagggttattgcctt |
269 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26841828 |
gttttaatcccctgcgtggttccctgtaagcggagggttattgcctt |
26841874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 26841455 - 26841494
Alignment:
| Q |
1 |
ttttttaataggatgattggcttgatcattaggatggatc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26841455 |
ttttttaataggatgattggcttgatcattaggatggatc |
26841494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University