View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10659_low_9 (Length: 245)
Name: NF10659_low_9
Description: NF10659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10659_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29599166 - 29598947
Alignment:
| Q |
1 |
ttataaaattacaatcttaaaaaagagaatattaaacgccttaaaataaagagaggatattactttcannnnnnnnnnnngaaaatgaatattactttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29599166 |
ttataaaattacaatcttaaaaaagagaatattaaacgccttaaaataaagagagga----actttcatttttttttt--gaaaatgaatattactttaa |
29599073 |
T |
 |
| Q |
101 |
tgttataccatcaattttaaaatttgtttataatcaagatttcaacaataaccaattaagaattgaatgattcttttcnnnnnnnggtataaaataattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29599072 |
tgttataccatcaattttaaaatttgtttataatcaagatttcaacaataaccaattaagaattgaatgattcttttctttttttggtataaaataattg |
29598973 |
T |
 |
| Q |
201 |
agtgattcctatttttatatatttta |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29598972 |
agtgattcctatttttatatatttta |
29598947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University