View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1065_high_4 (Length: 312)
Name: NF1065_high_4
Description: NF1065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1065_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 29 - 91
Target Start/End: Complemental strand, 34720904 - 34720842
Alignment:
| Q |
29 |
aattaagaaagaaaggttgcaacacatgtcgagcatttccgacgaaaaaatgcatcgtgcatt |
91 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
34720904 |
aattaagaaaggaaggttgcaacacatgtcgagcatttccgacaaaaaaatgcatcgttcatt |
34720842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University