View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1065_high_6 (Length: 279)
Name: NF1065_high_6
Description: NF1065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1065_high_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 34 - 279
Target Start/End: Complemental strand, 14706095 - 14705850
Alignment:
| Q |
34 |
gcatgattatatttgtttgaatgttgatgttttccttaaaattgcacttttgtgtagtatatgactatatgttgtggatgagcacggtaacttgaagcag |
133 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14706095 |
gcatgattatatttgtttcaatgttgatgttttccttaaaattgcacttttgtgtagtatatgactatatgttgtggatgagcacggtaacttgaagcag |
14705996 |
T |
|
| Q |
134 |
ttttaagattaaacaatgatcataatttatgaatttgtttgcttttagcttaactttttaagaagtgattatatataataatgatatagtcgtgtatata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705995 |
ttttaagattaaacaatgatcataatttatgaatttgtttgcttttggcttaactttttaagaagtgattatatataataatgatatagtcgtgtatata |
14705896 |
T |
|
| Q |
234 |
ctagatttctcaacagcatttcagtgtttatctcatggcaaatttt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705895 |
ctagatttctcaacagcatttcagtgtttatctcatggcaaatttt |
14705850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University