View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1065_low_6 (Length: 314)
Name: NF1065_low_6
Description: NF1065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1065_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 55 - 189
Target Start/End: Complemental strand, 40141580 - 40141447
Alignment:
| Q |
55 |
cacagacatttgctttattccatagtttattactgaatgaatccaattgagtctctcttggactnnnnnnncaaaagtcacaaagcgaaaaatgtgacaa |
154 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40141580 |
cacagacatttgctttattccattgtttattactgaatgaatccaattgagtctctcttggactaaaaaaacaaaagtcacaaagcgaaaaatgtgacaa |
40141481 |
T |
 |
| Q |
155 |
gtagatcacagaaagagtaaagggcaaacttgata |
189 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |
|
|
| T |
40141480 |
gtagatcacagaaagagt-aatggcaaacttgata |
40141447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University