View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1065_low_8 (Length: 305)
Name: NF1065_low_8
Description: NF1065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1065_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 302
Target Start/End: Original strand, 1583442 - 1583728
Alignment:
| Q |
16 |
attatgaaaagagggatttgtgcaagtaaatctcttgatattagtataataatttgagcaattgtcctcttctaacatggaccaaagcatattatattga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1583442 |
attatgaaaagagggatttgtgcaagtaaatctcttgatattagtataataatttgagcaattgtcctcttccaacatggaccaaagcatattatattga |
1583541 |
T |
 |
| Q |
116 |
atcactaaacatagaccataatttacccgcaaaaggtatccacatgaatcaaaataaaggtattagtggagtattcctaggattttcaaatctttgtcca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1583542 |
atcactaaacatagaccataatttacccgcaaaaggtatccacatgaatcaaaataaaggtattagtggagtattcctaggattttcaaacctttgtcca |
1583641 |
T |
 |
| Q |
216 |
aatctactttgtttcattcactttttgataattaaacaactggtgtctagggtatacaaataacatgttagatcgggttgtatgtga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1583642 |
aatctactttgtttcattcactttttgataattaaacaactggtgtctagggtatacaaataacatgttagatcgggttgcatgtga |
1583728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University