View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_high_17 (Length: 229)
Name: NF10660_high_17
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 7 - 196
Target Start/End: Original strand, 16862156 - 16862339
Alignment:
| Q |
7 |
gacttcccacattccatgccttactgcaggcttgctttgtgtgagtcggatagtttcttgcttgcttggctttgtcgtgctagcaggttcatcaccttcc |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
16862156 |
gacttcacacattccatgccttactgcaggcttgctttgtgtgagtcagataggttcttgcttgcttggctctgtcgtgctagcaggttcattaccttcc |
16862255 |
T |
 |
| Q |
107 |
tctttaaatcaactttgtccttaaggttgaatatagggtcctgctcttcacattcctagttgggcataggcaatggatgtagaagaccat |
196 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16862256 |
tctttaaatcaa------ccttaaggttgaatatagggtcctgctctttacattcctggttgggcataggcaatggatgtagaagaccat |
16862339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University