View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_high_19 (Length: 227)
Name: NF10660_high_19
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 56 - 160
Target Start/End: Original strand, 46719021 - 46719125
Alignment:
| Q |
56 |
taaaattccttttacaaatttggtcaagattagggacattgagtttaaacttgttcttcgaaaacgcgtgtattatttgtagtgtgagatgaatttattt |
155 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46719021 |
taaaattccttttacaaatttaatcaagattagagacattgagtttaaacttgttcttcgaaaacgcgtgtattatttatagtgtgagatgaatttattt |
46719120 |
T |
 |
| Q |
156 |
ctgat |
160 |
Q |
| |
|
||||| |
|
|
| T |
46719121 |
ctgat |
46719125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 214
Target Start/End: Original strand, 46719125 - 46719153
Alignment:
| Q |
186 |
tcacctaatatttatttgttctttcttct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46719125 |
tcacctaatatttatttgttctttcttct |
46719153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University