View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10660_high_19 (Length: 227)

Name: NF10660_high_19
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10660_high_19
NF10660_high_19
[»] chr7 (2 HSPs)
chr7 (56-160)||(46719021-46719125)
chr7 (186-214)||(46719125-46719153)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 56 - 160
Target Start/End: Original strand, 46719021 - 46719125
Alignment:
56 taaaattccttttacaaatttggtcaagattagggacattgagtttaaacttgttcttcgaaaacgcgtgtattatttgtagtgtgagatgaatttattt 155  Q
    |||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
46719021 taaaattccttttacaaatttaatcaagattagagacattgagtttaaacttgttcttcgaaaacgcgtgtattatttatagtgtgagatgaatttattt 46719120  T
156 ctgat 160  Q
    |||||    
46719121 ctgat 46719125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 214
Target Start/End: Original strand, 46719125 - 46719153
Alignment:
186 tcacctaatatttatttgttctttcttct 214  Q
    |||||||||||||||||||||||||||||    
46719125 tcacctaatatttatttgttctttcttct 46719153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University