View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_13 (Length: 295)
Name: NF10660_low_13
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 40669372 - 40669103
Alignment:
| Q |
11 |
cacagaactcacagccgaatggaacataaaactcttgctttcaaaccctaacggccatcttcgaatttcctaccaccacgatgcatttcatggcaagata |
110 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669372 |
cacaaaactctcagccgaatggaacataaaactcttgctttcaaaccctaacggccatcttcgaatttcctaccaccacgatgcatttcatggcaagata |
40669273 |
T |
|
| Q |
111 |
ttttacaggaatcagcaaggacgtcccgacaacgatattattcttgaaacctcaactttgcaatcatttttcaatggcaacaacatggtccagattaaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669272 |
ttttacaggaatcagcaaggacgtcccgacaacgatattattcttgaaacctcaactttgcaatcatttttcaatggcaacaacatggtccagattaaat |
40669173 |
T |
|
| Q |
211 |
tgaacgttgacacgtacgtgggctcctacatggcggagaaaattgatctgagccgtcgcaaccatggaat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40669172 |
tgaacgttgacacgtacgtgggctcctacatggcggagaaaattgatttgagccgtcgcaaccatggaat |
40669103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 117
Target Start/End: Complemental strand, 40663038 - 40662932
Alignment:
| Q |
11 |
cacagaactcacagccgaatggaacataaaactcttgctttcaaaccctaacggccatcttcgaatttcctaccaccacgatgcatttcatggcaagata |
110 |
Q |
| |
|
|||| |||||||||| |||||||| || | ||||| || |||||||||||| |||| | ||||| || |||||||||||| ||||| || ||||||| |
|
|
| T |
40663038 |
cacaaaactcacagctgaatggaaaattacactctccctatcaaaccctaactaccatttgcgaatctcataccaccacgattcatttgatcccaagata |
40662939 |
T |
|
| Q |
111 |
ttttaca |
117 |
Q |
| |
|
||||||| |
|
|
| T |
40662938 |
ttttaca |
40662932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University