View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_22 (Length: 259)
Name: NF10660_low_22
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 4852153 - 4851925
Alignment:
| Q |
17 |
agagaaaatagagaacccatgtataatctattaatctgacacaattaaagtgttgaatcgttttctcttttgaatgcttttcagtagagaatagagatac |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4852153 |
agagaaaacagagaacccatgtataatctattaatctgacacaattaaagcgttgaatcgttttctcttttgaatgcttttcagtagagaatagagatac |
4852054 |
T |
|
| Q |
117 |
accttgagcgacaagtaattgt-----tagatatcacttttgtatcaaaaggttgcttagataatgttggcaataaggtattataatatgatgacttgtc |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4852053 |
accttgagcgacaagtaattgtactaatagatatcacttttgtatcaaaaggttgcttagataatgttggcaataaggtattagaatatgatgacttgtc |
4851954 |
T |
|
| Q |
212 |
ctttcatgcatagacattattgtaccctc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4851953 |
ctttcatgcatagacattattgtaccctc |
4851925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University