View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_36 (Length: 235)
Name: NF10660_low_36
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 50935786 - 50935579
Alignment:
| Q |
13 |
caaagggtaaggtttctatagtgtagatgcagtttatattgagccgtagttatcacatcacaaattagtcacattatggatcctcctatcatgttacttt |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50935786 |
caaaaggtaaggtttctatagtgtagatgcagtttatattgagccgtagttatcacatcacaaattagtcacattatggatcctcctatcatgttgcttt |
50935687 |
T |
|
| Q |
113 |
tgattatagcgtatgccatctgacattactagaaaaagttgaaataacaacagatatttagagatgtaaaaatgtgaattcagtttctaatccgcctcaa |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50935686 |
tgattatagcgtatgccatctgacactactagaaaaagttgaaataacaacagatatttagagatgtaaaaatgtgaattcagtttctaatccgcctcaa |
50935587 |
T |
|
| Q |
213 |
gtagtaga |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
50935586 |
gtagtaga |
50935579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University