View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_37 (Length: 230)
Name: NF10660_low_37
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 32812650 - 32812853
Alignment:
| Q |
18 |
acaaaaagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttccgaatggagagcttttggtgtcttcatggtgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812650 |
acaaaaagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttccgaatggagagcttttggtgtcttcatggtgga |
32812749 |
T |
|
| Q |
118 |
ggttagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtagtttatcataagaaggatattatactattgttcccttcttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812750 |
ggttagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtggtttatcataagaaggatattatactattgttcccttcttt |
32812849 |
T |
|
| Q |
218 |
tcac |
221 |
Q |
| |
|
|||| |
|
|
| T |
32812850 |
tcac |
32812853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 23 - 216
Target Start/End: Original strand, 32830185 - 32830378
Alignment:
| Q |
23 |
aagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttccgaatggagagcttttggtgtcttcatggtggaggtta |
122 |
Q |
| |
|
||||||| ||||||| |||||||| |||||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||| || |
|
|
| T |
32830185 |
aagaatgagtgatgaatatgcaagatctattattgattggggagagttgtataatggttttccaaatggggatgttttggtgtcttcatggtggaggcta |
32830284 |
T |
|
| Q |
123 |
gggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtagtttatcataagaaggatattatactattgttcccttctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||| || ||||||| |
|
|
| T |
32830285 |
gggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtcctgtggtttatcataggaaggatattatactattatttccttctt |
32830378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University