View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_42 (Length: 215)
Name: NF10660_low_42
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 1716596 - 1716410
Alignment:
| Q |
16 |
gagaatgagaatgtgaaaaatggttgctttgaaaactttgagccaaattttgagtagaaaaatagtagcttcacagtaacattgttgtaactaatttgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1716596 |
gagaatgagaatgtgaaaaatggttgctttgaaaactttgagccaaattttgagtagaaaaatagtagcttcacagaaacattgttgtaactaatttgtg |
1716497 |
T |
|
| Q |
116 |
acggcctaggtatattttgttttgtcgtttgttggtattgctgtcattgaggtgaaaaacggccagtactgtactaacattgtttgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1716496 |
acggcctaggtatattttgttttgtcgtttgttggtattgctatcattgaggtgaaaaacggccagtactgtactaacattgtttgt |
1716410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University