View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_43 (Length: 212)
Name: NF10660_low_43
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 40861703 - 40861537
Alignment:
| Q |
20 |
attagagttgtgatatttaaacataaaattaattctatttatttatcccttatttttcatcttattgcaaaataaacgaaata--aaaaggtacactgta |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40861703 |
attagagttatgatatttaaacataaaattaattctatttatttatcccttatttttcatcttattgcaaaataaacgaaataaaaaaaggtacactgta |
40861604 |
T |
 |
| Q |
118 |
tttttatcaattttgtgtgaccgtttaata-----tttattttattatacatagataatattataca |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
40861603 |
tttttatcaattttgtgtgaccgtttaatatttattttattttattatacatagataatgttataca |
40861537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University