View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10660_low_44 (Length: 205)
Name: NF10660_low_44
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10660_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 145 - 191
Target Start/End: Original strand, 6251638 - 6251684
Alignment:
| Q |
145 |
acatccatattataaactaaatacatcagtttttattgactaatttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6251638 |
acatccatattataaactaaatacatcaatttttattgactaatttg |
6251684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 6111412 - 6111465
Alignment:
| Q |
1 |
taacatgttcccagcactgttcgtgttttcctctacccatgatcaatatctttc |
54 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
6111412 |
taacatgtttccagcagtgctcgtgttttcctctacccattatcaatatctttc |
6111465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 6183551 - 6183626
Alignment:
| Q |
32 |
tctacccatgatcaatatctttctggcagtc---ctcggttgaattcaaaaaactgaataaacatacagtatatat |
104 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||||||| |||| || ||||| |||||||||||||| |
|
|
| T |
6183551 |
tctacccattatcaatatctttccggcagtcgtcctcggttgaattctaaaacctaaataagcatacagtatatat |
6183626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University