View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_high_14 (Length: 240)
Name: NF10661_high_14
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4377719 - 4377942
Alignment:
| Q |
1 |
taaaatttcttctctatagtttgagtcaagatactatatatggcttcaggttttaaatgttgccttgtaccgtaagttaatttcctctcttagatcattt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4377719 |
taaaatttcctctctatagtttgagtcaagatactatatatggcttcaggttttaaatgttgccttgtaccgtaagttaatttcctctcttagatcattt |
4377818 |
T |
|
| Q |
101 |
tgtggctatgcttaaagaaaatgacttttctttgatggcgtgtgcccaattaaatagaatcactagtgacctctttttccccacggttgatctattattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4377819 |
tgtggctatgcttaaagaaaatgacttttctttgatggtgtgtgcccaattaaatagaatcaccggtgacct-tttttcctcacggttgatctattattt |
4377917 |
T |
|
| Q |
201 |
gaaaatgataatgat-gagtgtcgt |
224 |
Q |
| |
|
||||||||||| ||| ||||||||| |
|
|
| T |
4377918 |
gaaaatgataaagatcgagtgtcgt |
4377942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 34 - 206
Target Start/End: Original strand, 4373261 - 4373431
Alignment:
| Q |
34 |
ctatatatggcttcaggttttaaatgttgccttgtaccgtaagttaatttcctctcttagatcattttgtggctatgcttaaagaaaatgacttttcttt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4373261 |
ctatatatggcttcaggttttaaatgttgccttgtactgtaagttaatttcctctcttagatcattttgtggctaagctctaagaaaatgacttttcttt |
4373360 |
T |
|
| Q |
134 |
gatggcgtgtgcccaattaaatagaatcactagtgacctctttttccccacggttgatctattatttgaaaat |
206 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4373361 |
gatggtgtgtgcccaattaaaatgaatcactagtga--tctctttccccacggttgatctattattcgaaaat |
4373431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University