View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_high_15 (Length: 236)
Name: NF10661_high_15
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_high_15 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 236
Target Start/End: Original strand, 42373285 - 42373507
Alignment:
| Q |
14 |
ctttcttcgtcgccgcgtagagacttgccggttggtctgttcgatctttctccgaaaacggaaccttcgaattcaatccataaacggagctggacgaagc |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373285 |
ctttcttcgtcgccgcgtagagactcgccggttggtctgttcgatctttctccgaaaaaggaaccttcgaattcaatccataaacggagctggacgaagc |
42373384 |
T |
 |
| Q |
114 |
ccaaacaattgatggttgaggatttgcagatttacacgcttctagaagaacggtgaaaccagcgaggttgctgtgaacgtatgagttagggttttgcata |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373385 |
ccaaacaattgctggttgaggatttgcagatttacacgcttctagaagaacggtgaaaccagcgaggttgctgtgaacgtatgagttagggttttgcata |
42373484 |
T |
 |
| Q |
214 |
gcataacgaacaccagcttgtgc |
236 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
42373485 |
gcatagcgaacaccagcttgtgc |
42373507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 42179334 - 42179385
Alignment:
| Q |
185 |
tgtgaacgtatgagttagggttttgcatagcataacgaacaccagcttgtgc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42179334 |
tgtgaacgtatgagctagggttttgcatagcataacgaacaccagcttgtgc |
42179385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 137
Target Start/End: Original strand, 8315934 - 8316004
Alignment:
| Q |
67 |
gaaaacggaaccttcgaattcaatccataaacggagctggacgaagcccaaacaattgatggttgaggatt |
137 |
Q |
| |
|
||||| |||||||| | ||||||||||||||| || || || ||||||||||||||| ||||||||||| |
|
|
| T |
8315934 |
gaaaaaggaaccttagtattcaatccataaacagaactagaactagcccaaacaattgaaggttgaggatt |
8316004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 147
Target Start/End: Original strand, 3519989 - 3520122
Alignment:
| Q |
14 |
ctttcttcgtcgccgcgtagagacttgccggttggtctgttcgatctttctccgaaaacggaaccttcgaattcaatccataaacggagctggacgaagc |
113 |
Q |
| |
|
||||||||||||| || |||||||| || ||||| || |||||||| || |||||||| ||| ||||||||| || || ||||| || || || ||||| |
|
|
| T |
3519989 |
ctttcttcgtcgctgcatagagactagcaggttgatccgttcgatccttttccgaaaaaggagtcttcgaatttaacccgtaaaccgaactcgaagaagc |
3520088 |
T |
 |
| Q |
114 |
ccaaacaattgatggttgaggatttgcagattta |
147 |
Q |
| |
|
||||||| | |||||||| ||||| |||||| |
|
|
| T |
3520089 |
gtaaacaatcgccggttgagggtttgccgattta |
3520122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 233
Target Start/End: Original strand, 3520882 - 3520935
Alignment:
| Q |
180 |
gttgctgtgaacgtatgagttagggttttgcatagcataacgaacaccagcttg |
233 |
Q |
| |
|
|||||||||||| || || ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
3520882 |
gttgctgtgaacatacgaattagggtttcgcatagcataacgaaccccagcttg |
3520935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University