View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_high_3 (Length: 441)
Name: NF10661_high_3
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 20 - 423
Target Start/End: Complemental strand, 41418614 - 41418203
Alignment:
| Q |
20 |
tttaaaatttggacgtaggagctggatagaaaaattttcatttttcaacatatcgagatgggggctcacgaagaaaccttggtggaagcagcgctccgag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418614 |
tttaaaatttggacgtaggagctggatagagaaattttcatttttcaacatatcgagatgggggctcacgaagaaaccttggtggaagcagcgctccgag |
41418515 |
T |
 |
| Q |
120 |
ttttgaacaccgccgacccattcgagaaggcgcgactcggcgactcagtagcttcacggtggctcgatggcaccatcgccgaaccctacaacccttccct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418514 |
ttttgaacaccgccgacccattcgagaaggcgcgactcggcgactcagtagcttcacggtggctcgatggcaccatcgccgaaccctacaacccttccct |
41418415 |
T |
 |
| Q |
220 |
cacccttcccatccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataatccttttactgtgttcgacgaaattcctcactgaca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418414 |
cacccttcccatccctgatcgccccgcaaggctctccagtgtctctgcactttctttccaataatccttttactgtgttcgacgaaattcctcactgaca |
41418315 |
T |
 |
| Q |
320 |
taaatggcttat--------tttgcaggtgaagttggtggctccgagtctcatgccgaagttgggtaaagcaggaagcttgcaaagcagggtgaacattg |
411 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41418314 |
taaatggcttattttgttgttttgcaggtgaagttggtggctccgagtctcatgccgaagttgggtaaagcaggaagcttgcaaagcagggtgaacattg |
41418215 |
T |
 |
| Q |
412 |
tgcatagtcttg |
423 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41418214 |
tgcatagtcttg |
41418203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University