View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_high_7 (Length: 327)
Name: NF10661_high_7
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 21 - 316
Target Start/End: Original strand, 8088219 - 8088513
Alignment:
| Q |
21 |
gactctctcagtgtgctcaaagctttcaatacataggttggtgtcccttggaggatgcaggctagatggcataattgcatgcattactgcaagcagatca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8088219 |
gactctctcagtgtgctcaaagctttcaatacacaggttggtgtgccttggaggatgcaggctagatggcataattgtatgcattactgcaagcagatca |
8088318 |
T |
 |
| Q |
121 |
attgctctttttctcatgcgctcagagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtggga |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8088319 |
attgctctttttctcatgcgctcaaagaagtcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtggga |
8088418 |
T |
 |
| Q |
221 |
tctcccccctccctttgtagccacctacctttatagggattctctagggctgccttttactagattttccatggattgattttgtatatggttcat |
316 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8088419 |
tc-accccctccctttgtagccacctacctttatagggattctctagggctgccttttactagattttccatggattaattttgtatatggttcat |
8088513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 169 - 220
Target Start/End: Original strand, 25061561 - 25061612
Alignment:
| Q |
169 |
ctttggccaaaaatggccaaagccttgctttgtactcttcacaatggtggga |
220 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
25061561 |
ctttggccaagaatggcgaaagccttgctatgtactcttcccaatggtggga |
25061612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 144 - 205
Target Start/End: Complemental strand, 44652485 - 44652424
Alignment:
| Q |
144 |
agagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactc |
205 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| || ||||||||| | |||||||||||||| |
|
|
| T |
44652485 |
agagaaggcaacttggtggctgatgccttggctaagaatggccaaggtcttgctttgtactc |
44652424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 786993 - 787073
Alignment:
| Q |
141 |
ctcagagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtgggat |
221 |
Q |
| |
|
||||||||||| ||||| || || ||| | || ||||| ||||||||||||||||| ||| ||| || |||||||||||| |
|
|
| T |
786993 |
ctcagagaagggaacttggtagcagatgccttagccaagaatggccaaagccttgccatgttctcctctcaatggtgggat |
787073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University