View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_low_22 (Length: 295)
Name: NF10661_low_22
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 23009093 - 23009372
Alignment:
| Q |
1 |
aattggatgatttagagatgaacatcccctttataggaagattagctaaaacaactgcaannnnnnnnnnnatgaaggcaagaaagtcaagctgagataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
23009093 |
aattggatgatttagagatgaacatcccctttataggaagattagattaaacaactgcaatttttttttt-atgaaggcaagaaagtcaagccgagataa |
23009191 |
T |
|
| Q |
101 |
ggaattcaagctcaacttcagccatagcccaattgaattcgaaagcagaagttgtgcttcaacacctcgagaaagctgcctcatttgaaaaggaaattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23009192 |
ggaattcaagctcaacttcagccatagcccaattgaattcgaaagcagaagttgtgcttcaacacctcgagaaagctgccacatttgaaaaggaaattgt |
23009291 |
T |
|
| Q |
201 |
tgcattactgacatctgaatttctcatcaacacaaagttggagcatgccgaagcagcttacgaagctctaaagcaaaactt |
281 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23009292 |
tgcattagtgacatctaaatttctcatcaacacaaagttggagcatgtcgaagcagcttacgaagctctaaagcaaaactt |
23009372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University