View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_low_26 (Length: 267)
Name: NF10661_low_26
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 6188115 - 6187867
Alignment:
| Q |
15 |
taaagagaatgatctgattggaagagagaggtaaggtgaaattctagtgtttaaaaataaggg-ttacaagtatcattgttggtttaaaagcaacaacgg |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
6188115 |
taaagagaatgatgtgattggaagagagaggtaaggtgaaattctagtgtttgaaaataaaggattacaagtagcattgttggtttgaaagcaacaacgg |
6188016 |
T |
 |
| Q |
114 |
attaaaaacttggattaaaataatttgtgatataaacgtagtgatttcatacaagatgaaatatctaatcaaatgatttcttgaattagctaggttgaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6188015 |
attaaaaacttggattaaaataatttgtgatataaacgtagtgatttcatacgagatgaaatatctaatcaaatgatttcttgaattaattaggttgaga |
6187916 |
T |
 |
| Q |
214 |
agatgacgaagacttcatcacaataagggaatcaatgtaagggaatcat |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| ||||||| |
|
|
| T |
6187915 |
agatgacgaagacttcatcacaataagagaatcacggtaagagaatcat |
6187867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University