View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_low_33 (Length: 245)
Name: NF10661_low_33
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 8418541 - 8418758
Alignment:
| Q |
18 |
agtaagcgtgtgcttggttttataagttgaatatacaattatttatgttttaatataatcacgtatatat-gtaaattgaaaaataaatttaagagcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||| | |||| ||||||||||||||| |||||||| |
|
|
| T |
8418541 |
agtaagcgtgtgcttggttttataagctgaatatacaattatttatgttttaaaataatcacctataagtagtaagttgaaaaataaattttagagcatt |
8418640 |
T |
|
| Q |
117 |
ttgaaaacaaaaactattatagcaaagaacatttaaacattttaaaatcaattttacgctcataaaatcacttttgtacatgcaccatgtctgaatcaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8418641 |
ttgaaaacaaaaactattatagcatagaacatttaaacattttaaactcaattttacgcacataaaatcacttttgtacatgcaccatgtgtgaatcaaa |
8418740 |
T |
|
| Q |
217 |
gtctaggtttagattcat |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8418741 |
gtctaggtttagattcat |
8418758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University