View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10661_low_40 (Length: 226)

Name: NF10661_low_40
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10661_low_40
NF10661_low_40
[»] chr5 (1 HSPs)
chr5 (1-115)||(7568945-7569059)
[»] chr8 (1 HSPs)
chr8 (1-107)||(33126286-33126392)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 7569059 - 7568945
Alignment:
1 agcaaagccaaatcataatctataagtggtatgtctagtgctgggtgtctaagcctcaaattgtagtaaacagttgacaatgatgcacccataatcatac 100  Q
    ||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||| |||||||||||||||||| |||| |||||||||||||||||    
7569059 agcaaagccaaatcataatctataagtggcatgtctagtgttgggtttctaagcctcatattgtagtaaacagttgataatgctgcacccataatcatac 7568960  T
101 ctgcaattaccaaat 115  Q
    ||||||||| |||||    
7568959 ctgcaattatcaaat 7568945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 33126286 - 33126392
Alignment:
1 agcaaagccaaatcataatctataagtggtatgtctagtgctgggtgtctaagcctcaaattgtagtaaacagttgacaatgatgcacccataatcatac 100  Q
    |||||||| | |||||||||||||||||| |||||||||| ||||||||||||||||| |||||| || |||||||||   | ||| ||  |||||||||    
33126286 agcaaagcaagatcataatctataagtggcatgtctagtgttgggtgtctaagcctcagattgtaatacacagttgacccagctgctcctgtaatcatac 33126385  T
101 ctgcaat 107  Q
    |||||||    
33126386 ctgcaat 33126392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University