View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10661_low_40 (Length: 226)
Name: NF10661_low_40
Description: NF10661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10661_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 7569059 - 7568945
Alignment:
| Q |
1 |
agcaaagccaaatcataatctataagtggtatgtctagtgctgggtgtctaagcctcaaattgtagtaaacagttgacaatgatgcacccataatcatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||| |||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7569059 |
agcaaagccaaatcataatctataagtggcatgtctagtgttgggtttctaagcctcatattgtagtaaacagttgataatgctgcacccataatcatac |
7568960 |
T |
 |
| Q |
101 |
ctgcaattaccaaat |
115 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
7568959 |
ctgcaattatcaaat |
7568945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 33126286 - 33126392
Alignment:
| Q |
1 |
agcaaagccaaatcataatctataagtggtatgtctagtgctgggtgtctaagcctcaaattgtagtaaacagttgacaatgatgcacccataatcatac |
100 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||||||||| ||||||||||||||||| |||||| || ||||||||| | ||| || ||||||||| |
|
|
| T |
33126286 |
agcaaagcaagatcataatctataagtggcatgtctagtgttgggtgtctaagcctcagattgtaatacacagttgacccagctgctcctgtaatcatac |
33126385 |
T |
 |
| Q |
101 |
ctgcaat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
33126386 |
ctgcaat |
33126392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University