View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10662_high_10 (Length: 249)
Name: NF10662_high_10
Description: NF10662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10662_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 145 - 237
Target Start/End: Original strand, 617599 - 617691
Alignment:
| Q |
145 |
tttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacaaagtcaagtcaatatttatattttctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
617599 |
tttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacagagtcaagtcaatatttatattttctct |
617691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 146 - 216
Target Start/End: Original strand, 15370911 - 15370981
Alignment:
| Q |
146 |
ttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacaaagtcaa |
216 |
Q |
| |
|
|||||| | |||||||||||| |||||||||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
15370911 |
ttccttgataaaacttagacacccaagctgggataatgcctgaaggaggccaattagagtaacagagtcaa |
15370981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University