View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10662_high_10 (Length: 249)

Name: NF10662_high_10
Description: NF10662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10662_high_10
NF10662_high_10
[»] chr2 (1 HSPs)
chr2 (145-237)||(617599-617691)
[»] chr1 (1 HSPs)
chr1 (146-216)||(15370911-15370981)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 145 - 237
Target Start/End: Original strand, 617599 - 617691
Alignment:
145 tttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacaaagtcaagtcaatatttatattttctct 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
617599 tttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacagagtcaagtcaatatttatattttctct 617691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 146 - 216
Target Start/End: Original strand, 15370911 - 15370981
Alignment:
146 ttccttaacaaaacttagacatccaagctgggataatgcctgaaggagaccgattagagtaacaaagtcaa 216  Q
    |||||| | |||||||||||| |||||||||||||||||||||||||| || |||||||||||| ||||||    
15370911 ttccttgataaaacttagacacccaagctgggataatgcctgaaggaggccaattagagtaacagagtcaa 15370981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University