View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10663_high_2 (Length: 222)
Name: NF10663_high_2
Description: NF10663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10663_high_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 100 - 222
Target Start/End: Complemental strand, 6401111 - 6400989
Alignment:
| Q |
100 |
aaatcacccgaagtttgatagctgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttatcataacagaatatgtcgattgtat |
199 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6401111 |
aaattacccgaagtttgataactgatagttatgtaggtttatttctctgtgaaatttgtaacttttttccttttgtcataacagaatatgtcgattgtat |
6401012 |
T |
|
| Q |
200 |
atccatatacaacttctctttaa |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6401011 |
atccatatacaacttctctttaa |
6400989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University