View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10665_low_9 (Length: 207)
Name: NF10665_low_9
Description: NF10665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10665_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 29 - 193
Target Start/End: Complemental strand, 52729944 - 52729780
Alignment:
| Q |
29 |
atacaatacattacctagcaatataaaatgatgtacgaacagcagcaacggttacagcagacaccggtgaggaacaaatataacaattcgatagaagagg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52729944 |
atacaatacattacctagcaatataaaatgatgtacgaacagcagcaacggttacagcagacaccggtgaggaacaaatataacaattcgatagaagagg |
52729845 |
T |
 |
| Q |
129 |
aagagaggcttgaaatagttgatttgagtggcatgtcattggagtctcttcccaatccttctctt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52729844 |
aagagaggcttgaaatagttgatttgagtggcatgtcattggagtctcttcccaatccttctctt |
52729780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University