View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_high_17 (Length: 249)
Name: NF10666_high_17
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 5 - 153
Target Start/End: Complemental strand, 28927393 - 28927246
Alignment:
| Q |
5 |
agcaagcaactaccaagtcatggaaagaagatgcaaagtttcgagaagcatttaatgcagcattgaaaccatcttcacatctaactgatggaccaattga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28927393 |
agcaagcaactaccaagtcatggaaagaagatgcaaagttttgagaagcatttaatgcagcattgaaaccatcttcacatctaactgatggaccaattga |
28927294 |
T |
|
| Q |
105 |
ctttttgtttcaaaaactcaccatcaacggaggttaacatcttagatta |
153 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
28927293 |
ctttttgtttc-aaaattcaccatcaacagaggttaacatcttagatta |
28927246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University