View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10666_high_4 (Length: 363)

Name: NF10666_high_4
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10666_high_4
NF10666_high_4
[»] chr5 (1 HSPs)
chr5 (1-128)||(13430144-13430271)


Alignment Details
Target: chr5 (Bit Score: 84; Significance: 8e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 13430144 - 13430271
Alignment:
1 aacgggttggcagcgggacaaaccatcgacaaccacattgcaatgacccgagaagtacaatatttcaaagttgtagcccataagttttatcaaccattgt 100  Q
    ||||||||||||||||||||||||||||||||||||||| | |||||| |||||||| ||||||||||||| |||||| | ||||||| |||| ||| ||    
13430144 aacgggttggcagcgggacaaaccatcgacaaccacatttccatgacctgagaagtaaaatatttcaaagtcgtagcctagaagttttgtcaatcatcgt 13430243  T
101 tgggttgggatttgtatagtctgattca 128  Q
    |||||||||||||||||||| |||||||    
13430244 tgggttgggatttgtatagtttgattca 13430271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University