View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_high_4 (Length: 363)
Name: NF10666_high_4
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 8e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 13430144 - 13430271
Alignment:
| Q |
1 |
aacgggttggcagcgggacaaaccatcgacaaccacattgcaatgacccgagaagtacaatatttcaaagttgtagcccataagttttatcaaccattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||| |||||||| ||||||||||||| |||||| | ||||||| |||| ||| || |
|
|
| T |
13430144 |
aacgggttggcagcgggacaaaccatcgacaaccacatttccatgacctgagaagtaaaatatttcaaagtcgtagcctagaagttttgtcaatcatcgt |
13430243 |
T |
 |
| Q |
101 |
tgggttgggatttgtatagtctgattca |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
13430244 |
tgggttgggatttgtatagtttgattca |
13430271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University