View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_high_6 (Length: 324)
Name: NF10666_high_6
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 34836845 - 34836532
Alignment:
| Q |
1 |
cacagtttccccccaacttatatcatacaaagaggagccatatagtcttcatcttgcttcatgcacataatgtaacattgtgtactgggtccctatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34836845 |
cacagtttccccccaacttatatcatacaaagaggagccatacagtcttcatcttgcttcatgcacataatttaacattgtgtactgggtccctatatat |
34836746 |
T |
|
| Q |
101 |
catgcttttgcatcttagatttaatcgctatatttgagttca---------ttctcaatacaacatcatcaacattcctataattttcacattatgagtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34836745 |
gatgcttttgcatcttagatttaatcggtatatttgagttcagattgttcattctcaatacaacatcatcaacattcctataattttcacattatgagtt |
34836646 |
T |
|
| Q |
192 |
tattttatttttccattcttccttttgaggtgtacgatggagtacatatatgagatacaaaaatggcacaatccaagttgtaactttctttccccaactt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34836645 |
tattttatttttccattcttccttttgaggtgtacgatggagtacatatatgagatacaaaaatggcacaatccaagttgtaactttctttccccaactt |
34836546 |
T |
|
| Q |
292 |
cctcctaaggagct |
305 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34836545 |
cctcctaaggagct |
34836532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University