View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10666_low_12 (Length: 301)
Name: NF10666_low_12
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10666_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 42374049 - 42373767
Alignment:
| Q |
1 |
tttagagagttaataatatggcgcagcaagtgaataacgaaacaacaccttcaacaccggggaaattaaaaccggataaacctcatcaccgctttagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42374049 |
tttagagagttaataatatggcgcagcaagtgaataacgaaacaacaccttcaacaccggggaaattaaaaccggataaacctcatcaccgctttagaat |
42373950 |
T |
 |
| Q |
101 |
ccaccctccacattcaagatacacattcatctgcattctcttatccgcttttcttgtttttcttttattctccaccttcaaccctccaccaccgtcaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373949 |
ccaccctccacattcaagatacacattcatctgcattctcttatccgcttttcttgtttttcttttattctccaccttcaaccctccaccaccgtcaacc |
42373850 |
T |
 |
| Q |
201 |
accgcaccccgccgtgtcctcggtgactcatggggtggttctcactgggaacgtcttgtgtcgaaatcaactcgccggaattc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42373849 |
accgcaccccgccgtgtcctcggtgactcatggggtggttctcactgggaacgtcttgtgtcgaaatcaactcgccggaattc |
42373767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University