View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10666_low_22 (Length: 249)

Name: NF10666_low_22
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10666_low_22
NF10666_low_22
[»] chr1 (1 HSPs)
chr1 (5-153)||(28927246-28927393)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 5 - 153
Target Start/End: Complemental strand, 28927393 - 28927246
Alignment:
5 agcaagcaactaccaagtcatggaaagaagatgcaaagtttcgagaagcatttaatgcagcattgaaaccatcttcacatctaactgatggaccaattga 104  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28927393 agcaagcaactaccaagtcatggaaagaagatgcaaagttttgagaagcatttaatgcagcattgaaaccatcttcacatctaactgatggaccaattga 28927294  T
105 ctttttgtttcaaaaactcaccatcaacggaggttaacatcttagatta 153  Q
    ||||||||||| |||| ||||||||||| ||||||||||||||||||||    
28927293 ctttttgtttc-aaaattcaccatcaacagaggttaacatcttagatta 28927246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University